Pasar Vs Flu Singapura

1 Apr 2010

23798_383115068483_706233483_3613617_1745122_n1Hiks, kayaknya harus lebih bijak lagi deh kalau mau ajak anak “jalan”. Harus ke tempat yang benar-benar terjamin kebersihannya deh kalau terpaksa atau pengen ajak anak jalan, jangan asal. Karena lagi bosan belanja mingguan di fresh market kota wisata, eh karena lagi kesal dhing sama pedagang sayur langganan disana, dua minggu ini saya pilih belanja di pasar Kranggan. Dibandingkan fresh market, pasar kranggan ini memang (maaaaaaaf banget yak) agak kumuh dan kotor. Seperti biasa, tipe pasar tradisional yang dikelola pemerintah daerah, kan kurang begitu memperhatikan faktor kebersihan dan kenyamanan :(

Meski tidak bermaksud menuduh, tapi tidak mustahil yang namanya pasar pasti punya potensi menyebarkan/menularkan penyakit. Lha namanya juga tempat umum, apalagi kalau ditambahi embel-embel kurang bersih, wes yang namanya kuman pasti betah ngumpul dan nunggu kesempatan yang pas buat menclok ke pengunjung. Seperti yang dialami si kecil saya Aliyyah. Hari minggu pagi lalu, seperti biasa Aliyyah memang saya ajak ke pasar untuk belanja sayur dan keperluan dapur lainnya. Mengajak Aliyyah belanja di pasar memang hal yang rutin saya lakukan sejak dulu (tepatnya sejak fresh market kota wisata resmi dibuka). Saya memang tidak mempermasalahkan membawa anak belanja di pasar karena beda dengan pasar-pasar tradisional lain (yang dikelola pemerintah), fresh market yang setiap minggu saja kunjungi ini relatif lebih bersih dan nyaman. Hanya, karena saya sedang kesal seperti yang saya sebutkan diatas, dua minggu bertutur-turut kemaren saya ganti belanja di pasar Kranggan. Kalau dilihat dari masa inkubasinya yang 2-5 hari, berarti benar kan kemungkinan Aliyyah tertular penyakit ini di pasar kranggan, hehehe. Ngga dhing, pas kebetulan aja :P

Hari Selasa malam, karena keluhan demam (tidak begitu tinggi, sekitar 37-38) dan muncul bintik/ruam saya ajak si kecil ke dokter langganannya. Khawatir cacar, eh ternyata dokter mendiagnosa Aliyyah tertular virus HFMD. Jika “dunia” lebih mengenalnya dengan sebutan flu singapura, di Indonesia sudah lama dikenal sebagai penyakit Tangan, Kaki dan Mulut. Sesuai dengan namanya, virus ini memang menyerang daerah sekitar tangan, kaki, dan mulut penderitanya. Awalnya saya juga tidak mengira si kecil saya terkena flu singapur, tapi begitu dokter “mempelajari” bintik/ruam dan pola penyebarannya di tangan, kaki, dan mulut Aliyyah … dan membuktikannya dengan menemukan ulkus (semacam sariawan) di rongga mulut, lidah dan pipi dalam Aliyyah, akhirnya saya pasrah waktu dokter berkata Aliyyah poitif flu singapura. Hiks, anakku tertular virus populer yang tidak kuinginkan :(

Kata dokter, penyakit ini sangaaaaaaaaat menular. Dan ….. (maaf) berbahaya kalau tidak ditangani dengan cepat dan tepat, Hiii ngeri, naudzubillah, masa katanya kalau sampai komplikasi bisa menyerang otak (meningitis), jantung, atau membuat lumpuh. Sebagai pengobatan, dokter memberikan obat untuk Aliyyah anti virus, vitamin dan cairan antiseptik. Dan karena daya tahan tubuh dipastikan sedang turun, agar tidak menjadi parah dan tentunya menular ke yang lain, sementara untuk waktu kurang lebih seminggu Aliyyah disarankan “dikarantina”. Blas tidak boleh keluar rumah, apalagi sekolah. Satu pesan dokter untuk saya, jika di hari ke-4 Aliyyah masih menujukkan salah satu gejala, tetap demam >37, lemah, dan tidak nafsu makan … maka saya harus kembali ke dokter. Aduh, mudah-mudahan tidak sampai kembali ke dokter ya, mohon doanya teman-teman untuk kesembuhan si kecil saya.

Berikut informasi seputar HFMD yang saya ambil dari situs http://medicastore.com

Flu Singapore atau Hand Foot Mouth Disease (HFMD)

DEFINISI
“Flu Singapore” sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM).

Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.
Istilah ?Flu Singapore? muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah ?flu Singapore?, walaupun ini bukan terminologi yang baku.

PENYEBAB
PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena.
Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa.
Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya.
Masa Inkubasi 2 ? 5 hari.

GEJALA
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.

Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit. Gejala yang cukup berat tersebut antara lain :
- Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C. - Demam tidak turun-turun - Takikardia (nadi menjadi cepat) - Takipneu, yaitu napas jadi cepat dan sesak - Malas makan, muntah, atau diare berulang dengan dehidrasi. - Letargi, lemas, dan mengantuk terus - Nyeri pada leher, lengan, dan kaki. - Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial - Keringat dingin - Fotofobia (tidak tahan melihat sinar) - Ketegangan pada daerah perut - Halusinasi atau gangguan kesadaran

Komplikasi penyakit ini adalah :
- Meningitis (radang selaput otak) yang aseptik - Ensefalitis (radang otak) - Myocarditis (Coxsackie Virus Carditis) atau pericarditis - Acute Flaccid Paralysis / Lumpuh Layuh Akut (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (PTKM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

DIAGNOSA
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :
- Immuno histochemistry (in situ)
- Imunofluoresensi antibodi (indirek)
- Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

PENGOBATAN
1. Istirahat yang cukup
2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.
3. Dapat diberikan :
- Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
- Extracorporeal membrane oxygenation.
4. Pengobatan simptomatik :
- Antiseptik di daerah mulut
- Analgesik misal parasetamol
- Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
- Pengobatan suportif lainnya ( gizi dll )

Penyakit ini adalah ?self limiting diseases?, yaitu dapat sembuh dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.

Di Rumah sakit ?Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
- Daya tahan tubuh menurun.
- Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana PTKM termasuk pelaksanaan ?Universal Precaution?nya.


TAGS flu singapore virus


-

Author

Follow Me